Differences

This shows you the differences between two versions of the page.

Link to this comparison view

Both sides previous revision Previous revision
Next revision
Previous revision
aflp_454seq_for_pop_structure [2012/01/23 17:22]
anniearchambault
aflp_454seq_for_pop_structure [2012/02/02 20:51] (current)
anniearchambault
Line 1: Line 1:
 ====== AFLP-like step with 454 sequencing for studying population structure ====== ====== AFLP-like step with 454 sequencing for studying population structure ======
-In 2011, [[http://​www.plantevolution.org/​fr/​|Simon Joly]], researcher at the Jardin Botanique de Montréal, set up an experiment with Annie Archambault [[http://​qcbs.ca/​resources/​research-professionals/​research-professional-annie-archambault/​|research professional at the QCBS]], using one of the high throughput (or next-generation) sequencing methods to study ginseng (//Panax quinquefolius//​) population structure from southern Ontario and Quebec; which will be necessary for establishing conservation criteria for this rare plant species. The protocol used unidirectional amplicons sequencing on a the [[http://​www.roche.com/​products/​product-list.htm?​type=researchers&​id=4|Genome Sequencer FLX (GS-FLX) System]] with the current Titanium chemistry. The sequencing procedures were performed at the [[http://​www.gqinnovationcenter.com/​services/​sequencing/​technoMPSRocheGSFLX.aspx?​l=e|Centre d’Innovation McGill et Génome Québec]], and the protocol for DNA library preparation is described in the following sections.+In 2011, [[http://​www.plantevolution.org/​fr/​|Simon Joly]], researcher at the [[http://​www2.ville.montreal.qc.ca/​jardin/​jardin.htm|Jardin Botanique de Montréal]], set up an experiment with Annie Archambault [[http://​qcbs.ca/​resources/​research-professionals/​research-professional-annie-archambault/​|research professional at the QCBS]], using one of the high throughput (or next-generation) sequencing methods to study ginseng (//Panax quinquefolius//​) population structure from southern Ontario and Quebec; which will be necessary for establishing conservation criteria for this rare plant species. The protocol used unidirectional amplicons sequencing on a the [[http://​www.roche.com/​products/​product-list.htm?​type=researchers&​id=4|Genome Sequencer FLX (GS-FLX) System]] with the current Titanium chemistry. The sequencing procedures were performed at the [[http://​www.gqinnovationcenter.com/​services/​sequencing/​technoMPSRocheGSFLX.aspx?​l=e|Centre d’Innovation McGill et Génome Québec]], and the protocol for DNA library preparation is described in the following sections.
  
 ===== Methods ===== ===== Methods =====
Line 9: Line 9:
  
 === DNA extraction === === DNA extraction ===
-An amount of 10 microgramm ​of dried leaves was ground for one minute in a microcentrifuge tube with one tungsten bead in the [[http://​www.qiagen.com/​products/​tissuelyserii.aspx|TissuLyser (Qiagen)]]. Total DNA was extracted using EZ-10 Spin Column Genomic DNA kits for Plant Samples (BioBasics [[http://​www.biobasic.com/​products.jsp?​productCode=BS425&​productName=&​cas=&​haz=-1&​classID=2&​rd=0.4384178700324832|catalog number BS425-50]]) as recommended by the manufacturer. Quality and quantity of total DNA was evaluated by gel electrophoresis and by optical density measurement.+An amount of 10 milligramm ​of dried leaves was ground for one minute in a microcentrifuge tube with one tungsten bead in the [[http://​www.qiagen.com/​products/​tissuelyserii.aspx|TissuLyser (Qiagen)]]. Total DNA was extracted using EZ-10 Spin Column Genomic DNA kits for Plant Samples (BioBasics [[http://​www.biobasic.com/​products.jsp?​productCode=BS425&​productName=&​cas=&​haz=-1&​classID=2&​rd=0.4384178700324832|catalog number BS425-50]]) as recommended by the manufacturer. Quality and quantity of total DNA was evaluated by gel electrophoresis and by optical density measurement.
  
  
 === Genome complexity reduction === === Genome complexity reduction ===
-A modified AFLP strategy, inspired by the [[http://​www.keygene.com/​services/​technologies_CRoPS.php|Crops technology]]((van Orsouw, N. J. et al. (2007). Complexity Reduction of Polymorphic Sequences (CRoPSTM): A Novel Approach for Large-Scale Polymorphism Discovery in Complex Genomes. [[http://​dx.plos.org/​10.1371/​journal.pone.0001172|PLoS ONE 2, e1172.]])) (AFLP and CRoPS are registered trademarks of Keygene N.V.) and a published study ((Gompert, Z., Forister, M. L., Fordyce, J. A., Nice, C. C., Williamson, R. J., and Alex Buerkle, C. (2010). Bayesian analysis of molecular variance in pyrosequences quantifies population genetic structure across the genome of Lycaeides butterflies. [[http://​doi.wiley.com/​10.1111/​j.1365-294X.2010.04666.x|Molecular Ecology, 19, 2455-2473]])) was applied to //Panax quinquefolius//​ total DNA, in order to efficiently discover sequence polymorphism in a wide and random range of the whole genome, but without actually sequencing the whole genome. One of the assumptions of this AFLP-like method is that restriction sites within the genome are conserved among populations. The steps are as follow:+A modified AFLP strategy, inspired by the [[http://​www.keygene.com/​services/​technologies_CRoPS.php|Crops technology]]((van Orsouw, N. J. et al. (2007). Complexity Reduction of Polymorphic Sequences (CRoPSTM): A Novel Approach for Large-Scale Polymorphism Discovery in Complex Genomes. [[http://​dx.plos.org/​10.1371/​journal.pone.0001172|PLoS ONE 2, e1172.]])) (AFLP and CRoPS are registered trademarks of Keygene N.V.) and a published study ((Gompert, Z., Forister, M. L., Fordyce, J. A., Nice, C. C., Williamson, R. J., and Alex Buerkle, C. (2010). Bayesian analysis of molecular variance in pyrosequences quantifies population genetic structure across the genome of //Lycaeides// butterflies. [[http://​doi.wiley.com/​10.1111/​j.1365-294X.2010.04666.x|Molecular Ecology, 19, 2455-2473]])) was applied to //Panax quinquefolius//​ total DNA, in order to efficiently discover sequence polymorphism in a wide and random range of the whole genome, but without actually sequencing the whole genome. One of the assumptions of this AFLP-like method is that restriction sites within the genome are conserved among populations. The steps are described in the following paragraphs. ​
  
 == Restriction-digestion of total DNA == == Restriction-digestion of total DNA ==
-The digestion with two different restriction enzymes used a moderate amount of DNA for each samples. Enzyme ​are a 4bp-cutter (here [[http://​www.neb.ca/​detail.php?​id=R0525|Mse1]],​ T/TAA) and a 6bp-cutter (here, [[http://​www.neb.ca/​detail.php?​id=R0101|EcoR1]],​ G/AATTC) that are not blunt-end, and leave a overhang of 2 (for Mse1) or 4 (for EcoR1) nucleotides. ​+The digestion with two different restriction enzymes used a moderate amount of DNA for each samples. Enzyme ​used were a 4bp-cutter (here [[http://​www.neb.ca/​detail.php?​id=R0525|Mse1]],​ T/TAA) and a 6bp-cutter (here, [[http://​www.neb.ca/​detail.php?​id=R0101|EcoR1]],​ G/AATTC) that are not blunt-end, and leave a overhang of 2 (for Mse1) or 4 (for EcoR1) nucleotides. ​
  
-**Table 1** Reagents for digestion of plant genomic DNA, at 37 °C for 3 hours.  ​+<WRAP box 500px>**Table 1** Reagents for digestion of plant genomic DNA, at 37 °C for 3 hours.  ​
 ^ Reagent ​   ^ Initial conc.    ^ Qty added    ^ Final conc. or Final qty    ^ ^ Reagent ​   ^ Initial conc.    ^ Qty added    ^ Final conc. or Final qty    ^
 ^ Template DNA    | 20 ng/​µl ​   | 9 µl    |180 ng    | ^ Template DNA    | 20 ng/​µl ​   | 9 µl    |180 ng    |
Line 27: Line 27:
 ^ H2O    | -    | 26.25 µl    | -    | ^ H2O    | -    | 26.25 µl    | -    |
 ^ Total volume ​   ^ -    ^ 40 µl    ^ -    ^ ^ Total volume ​   ^ -    ^ 40 µl    ^ -    ^
 +</​WRAP>​
  
 == Ligation of double stranded adaptors to the digested DNA ==  == Ligation of double stranded adaptors to the digested DNA == 
-Two different double-stranded adaptors were designed with the oligonucleotides listed in Table 2. Resuspended EcoRI_adapter1 and EcoRI_adapter2 oligonucleotides were mixed together, heated and slowly cool down to make the double stranded. The same procedure was applied to MseI_adapter1 and MseI_adapter2 oligonucleotides. EcoRI adaptor were diluted to a  final concentration of 5 micromolar (5 µM), while MseI adaptors were diluted to a final concentration of 50 micromolar (50 µM). +Two different double-stranded adaptors were designed with the oligonucleotides listed in Table 2. Resuspended EcoRI_adapter1 and EcoRI_adapter2 oligonucleotides were mixed together, heated ​at 95 C for 5 minutes, ​and slowly cool down to make the double stranded ​adaptor. The same procedure was applied to MseI_adapter1 and MseI_adapter2 oligonucleotides. EcoRI adaptor were diluted to a  final concentration of 5 micromolar (5 µM), while MseI adaptors were diluted to a final concentration of 50 micromolar (50 µM). 
  
-**Table 2** Oligonucleotides for preparation of double stranded adaptors. ​+<WRAP box 500px>**Table 2** Oligonucleotides for preparation of double stranded adaptors. ​
 ^ Oligo name      ^ Modification ​      ^ Sequence, 5' to 3' ​        ^ ^ Oligo name      ^ Modification ​      ^ Sequence, 5' to 3' ​        ^
 | EcoRI_adapter1 ​   |    | CTCGTAGACTGCGTACC ​   | | EcoRI_adapter1 ​   |    | CTCGTAGACTGCGTACC ​   |
Line 37: Line 38:
 | MseI adapter1 ​   | 5' phosphorylated ​   | TACTCAGGACTCAT ​   | | MseI adapter1 ​   | 5' phosphorylated ​   | TACTCAGGACTCAT ​   |
 | MseI adapter2 ​   |    | GACGATGAGTCCTGAG ​   | | MseI adapter2 ​   |    | GACGATGAGTCCTGAG ​   |
 +</​WRAP>​
 +<WRAP clear></​WRAP> ​
  
-Reaction mix for adaptor ligation ​to digested DNA is described in Table 3, it is performed in NEB4 Buffer ​with the double-stranded adaptors ​using [[http://​www.neb.ca/​detail.php?​id=M0202|T4 DNA ligase]] and [[http://​www.neb.ca/​detail.php?​id=P0756|additional ATP]]. Figure 1 illustrates the DNA fragments involved in the ligation ​step +Ligation of the double-stranded adaptors ​to digested DNA was performed in NEB4 Buffer using [[http://​www.neb.ca/​detail.php?​id=M0202|T4 DNA ligase]] and [[http://​www.neb.ca/​detail.php?​id=P0756|additional ATP]]. ​Table 3 describes the ligation reaction mix and Figure 1 illustrates the DNA fragments involved in adaptor ​ligation ​to digested DNA  ​
  
-[{{:​ligation_mix_.jpg|**Figure 1** Pictogram of the DNA fragments involved in the ligating double stranded adaptors to DNA previously digested with EcoRI and MseI restriction enzymes, in the context of a modified AFLP method for genome complexity reduction.}}] +<WRAP box 500px>**Table 3** Reagents for ligation of double stranded adaptors to previously digested DNA. A total volume of 10 µl of the ligation mix is added to the 40 µl volume of each digestion mix, and is incubated at 16 °C for 3 hours.  ​
- +
-**Table 3** Reagents for ligation of double stranded adaptors to previously digested DNA. A total volume of 10 µl of the ligation mix is added to the 40 µl volume of each digestion mix, and is incubated at 16 °C for 3 hours.  ​+
 ^ Reagent ​   ^ Initial conc.    ^ Qty added    ^ Final conc. or Final qty    ^ ^ Reagent ​   ^ Initial conc.    ^ Qty added    ^ Final conc. or Final qty    ^
 ^ NEB4 Buffer ​   | 10X | 1 µl  | 1X    | ^ NEB4 Buffer ​   | 10X | 1 µl  | 1X    |
Line 52: Line 53:
 ^ Volume added to digestion mix    | -    | 10 µl    | -    | ^ Volume added to digestion mix    | -    | 10 µl    | -    |
 ^ Total volume ​   ^ -    ^ 40 µl    ^ -    ^ ^ Total volume ​   ^ -    ^ 40 µl    ^ -    ^
- +</​WRAP>​ 
 +<WRAP clear></​WRAP>​  
 + 
 +<WRAP box 800px>​{{:​ligation_mix_.jpg|Ligation Mix}}<​WRAP box>​**Figure 1** Pictogram of the DNA fragments involved for ligating double stranded adaptors to DNA previously digested with EcoRI and MseI restriction enzymes, in the context of a modified AFLP method for genome complexity reduction.</​WRAP></​WRAP>​ 
 +<WRAP clear></​WRAP>​ 
  
 == Selective amplification by PCR using primers specific to the adaptor sequence ==  == Selective amplification by PCR using primers specific to the adaptor sequence == 
-The purpose of this step was to amplify only a small proportion of the total genome, thereby reducing the complexity of the nucleotides fragments pool that will be sequenced. ​In this step, the only the genomic fragments amplified were those that had a EcoR1 site on one side, and a Mse1 site on the other sideand additionally only those fragments that end by a C on the EcorR1 side and by a AC on the Mse1 side. The selective primers enabled what is termed a selective amplification. Because the selective primers were design to also have the MID (multiplex identifiers) barcodes, and the Lib-L segments used for the pyrosequencing step the selective amplification is described in the next section. ​Selective amplification is illustrated in Figure 2. +The purpose of this step was to amplify only a small proportion of the total genome, thereby reducing the complexity of the nucleotides fragments pool to be sequenced. ​The term selective refers to addition of one or two nucleotides at the 3' end of the adaptor-specific primers. This way, primers will amplify ​only a subset of the fragments that exist in the digested-ligated genome. These types of primers are termed selective primers. The only genomic fragments amplified ​in the present selective amplification ​were those that, in addition to having ​a EcoR1 site or a Mse1 site on each end of the sample DNAalso ended by a C on EcorR1 side and by a AC on Mse1 side. Because the selective primers were design to also carry the MID (multiplex identifiers) barcodes, and the LibL segments used for the pyrosequencing stepthe selective amplification is described ​in more details ​in the next section. Figure 2 illustrates the DNA fragments involved in selective amplification  ​
  
 === Pooling, multiplexing and barcoding samples for high throughput sequencing === === Pooling, multiplexing and barcoding samples for high throughput sequencing ===
-One feature to high throughput sequencing is the ability to multiplex different samples into a single sequencing run, which is made possible with the use of MID (multiplex identifiers). These are 10 bp long segments that were here added to the 5’ side of the EcoRI section of the selective primers. The barcodes are being sequenced along with the organism DNA, and are then recognized and sorted using bioinformatics methods. The complete list of MID for the Genome Sequencer FLX system is available [[http://​my454.com/​downloads/​my454/​documentation/​technical-bulletins/​TCB-09005_UsingMultiplexIdentifierAdaptorsForTheGSFLXTitaniumChemistry-ExtendedMIDSet.pdf|TCB No. 005-2009 April 2009 Using Multiplex Identifier (MID) Adaptors for the GS FLX Titanium Chemistry - Extended MID Set]]. Here, the 30 bp nucleotides segment (LibL-A and key) necessary for the sequencing instrument was further added to the 5’ side of the MID segment, following recommendations in [[http://​my454.com/​downloads/​my454/​applications-info/​APP001-2009-Lib-L-Unidirectional-Amplicons.pdf|APP No. 001-2009 unidirectional sequencing of Amplicon libraries using the GS FLX Titanium emPCR Kits (Lib-L)]]. In the present study, the 6 different ginseng populations were labeled with 6 different MID (multiplex identifiers) barcodes, but each sample of a population was labeled with the same population-specific barcode (Table 4). +One feature to high throughput sequencing is the ability to multiplex different samples into a single sequencing run, which is made possible with the use of MID (multiplex identifiers). These are 10 bp long segments that were here added to the 5’ side of the EcoRI section of the selective primers. The barcodes are being sequenced along with the organism DNA, and are then recognized and sorted using bioinformatics methods. The complete list of MID for the Genome Sequencer FLX system is available [[http://​my454.com/​downloads/​my454/​documentation/​technical-bulletins/​TCB-09005_UsingMultiplexIdentifierAdaptorsForTheGSFLXTitaniumChemistry-ExtendedMIDSet.pdf|TCB No. 005-2009 April 2009 Using Multiplex Identifier (MID) Adaptors for the GS FLX Titanium Chemistry - Extended MID Set]]. Here, the 30 bp nucleotides segment (LibL-A and key) necessary for the sequencing instrument was further added to the 5’ side of the MID segment, following recommendations in [[http://​my454.com/​downloads/​my454/​applications-info/​APP001-2009-Lib-L-Unidirectional-Amplicons.pdf|APP No. 001-2009 unidirectional sequencing of Amplicon libraries using the GS FLX Titanium emPCR Kits (Lib-L)]]. In the present study, the 6 different ginseng populations were labeled with 6 different MID (multiplex identifiers) barcodes, but each sample of a population was labeled with the same population-specific barcode (listed in Table 4). 
  
-**Table 4** Selective primers used for reducing the genomic complexity of the Panax genome, and for making amplified fragments suitable for multiplexing different samples in a single run of pyrosequencing on a GS-FLX instrument. ​ All oligonucleotides used as a forward primer include the LibL-A and the key segments necessary for the sequencing instrument, and the population-specific MID. They are followed by a unique EcoRI segment for the selective amplification. The reverse primer is made with a MseI segment (for selective amplification),​ and a LibL-B segment for the instrument. All oligonucleotides were purified by HPLC.+<WRAP box 800px>**Table 4** Selective primers used for reducing the genomic complexity of the Panax genome, and for making amplified fragments suitable for multiplexing different samples in a single run of pyrosequencing on a GS-FLX instrument. ​ All oligonucleotides used as a forward primer include the LibL-A and the key segments necessary for the sequencing instrument, and the population-specific MID. They are followed by a unique EcoRI segment for the selective amplification. The reverse primer is made with a MseI segment (for selective amplification),​ and a LibL-B segment for the instrument. All oligonucleotides were purified by HPLC.
 ^ Oligo name      ^  Sequence, 5' to 3' ​        ^ ^ Oligo name      ^  Sequence, 5' to 3' ​        ^
 | LibL_A_MID1_EcoRI_plus1 ​   | CCATCTCATCCCTGCGTGTCTCCGACTCAGACGAGTGCGTGACTGCGTACCAATTC ​   | | LibL_A_MID1_EcoRI_plus1 ​   | CCATCTCATCCCTGCGTGTCTCCGACTCAGACGAGTGCGTGACTGCGTACCAATTC ​   |
Line 70: Line 76:
 | LibL_A_MID2_EcoRI_plus1 ​   | CCATCTCATCCCTGCGTGTCTCCGACTCAGACGCTCGACAGACTGCGTACCAATTC ​   | | LibL_A_MID2_EcoRI_plus1 ​   | CCATCTCATCCCTGCGTGTCTCCGACTCAGACGCTCGACAGACTGCGTACCAATTC ​   |
 | LibL_B_MseI_plus2 ​   | CCTATCCCCTGTGTGCCTTGGCAGTCTCAGGATGAGTCCTGAGTAAC ​   | | LibL_B_MseI_plus2 ​   | CCTATCCCCTGTGTGCCTTGGCAGTCTCAGGATGAGTCCTGAGTAAC ​   |
 +</​WRAP>​
 +<WRAP clear></​WRAP>​
  
 Digested DNA samples were amplified in a PCR reaction where the reverse primer is LibL_B_MseI_plus2 for all tubes, and the forward primer is specific to a population (Table 4). However, since the objective of the study was to reveal the genetic diversity at the population level rather than between each individual, the ten //Panax quinquefolius//​ samples for each population were all labeled with a same set of barcoded population-specific primers. Each sample was however amplified separately prior to pooling, to ensure an equimolar representation in the pool. Figure 2 illustrates the DNA fragments involved in the selective amplification step. Digested DNA samples were amplified in a PCR reaction where the reverse primer is LibL_B_MseI_plus2 for all tubes, and the forward primer is specific to a population (Table 4). However, since the objective of the study was to reveal the genetic diversity at the population level rather than between each individual, the ten //Panax quinquefolius//​ samples for each population were all labeled with a same set of barcoded population-specific primers. Each sample was however amplified separately prior to pooling, to ensure an equimolar representation in the pool. Figure 2 illustrates the DNA fragments involved in the selective amplification step.
  
-[{{:​selective_amplification_mix.jpg?​1000|**Figure 2** Pictogram of the DNA fragments involved in selective amplification of previously digested-ligated DNA, in the context of a modified AFLP method for genome complexity reduction coupled to multiplexing samples for high throughput sequencing. The selective primers therefore also contain a barcode (MID), and an instrument specific region (Libl-A and Key), in addition to the template specific region (EcoRI).}}]+<WRAP box 800px>{{:​selective_amplification_mix.jpg?​700|Selective amplification pictogram}} 
 +<WRAP box>**Figure 2** Pictogram of the DNA fragments involved in selective amplification of previously digested-ligated DNA, in the context of a modified AFLP method for genome complexity reduction coupled to multiplexing samples for high throughput sequencing. The selective primers therefore also contain a barcode (MID), and an instrument specific region (Libl-A and Key), in addition to the template specific region (EcoRI).</​WRAP></​WRAP>​ 
 +<WRAP clear></​WRAP>​
  
 +Selective amplifications were performed with a highly accurate proofreading enzyme (iProof polymerase, BioRad, [[http://​www.bio-rad.com/​prd/​en/​CA/​adirect/​biorad?​cmd=BRCatgProductDetail&​productID=201001|catalog number 172-5301]]),​ to minimize risks of spurious single nucleotides polymorphisms that would be due to misincorporation of a nucleotide rather than genuine allelic variant. Reaction mix is given in Table 5, and cycling conditions in Table 6. Figure 3 shows an example of an agarose gel electrophorese of selective-amplification products, using [[http://​www.neb.ca/​detail.php?​id=N3014|Lambda BstEII]] as molecular ladder. ​
  
-Selective amplifications were performed with a highly accurate proofreading enzyme (iProof polymerase, BioRad, [[http://​www.bio-rad.com/​prd/​en/​CA/​adirect/​biorad?​cmd=BRCatgProductDetail&​productID=201001|catalog number 172-5301]]),​ to minimize risks of spurious single nucleotides polymorphisms that would be due to misincorporation of a nucleotide rather than genuine allelic variant. Reaction mix is given in Table 5, and cycling conditions in Table 6. Figure 3 shows an example of   +<WRAP box 500px>**Table 5** Reaction mix for selective amplifications,​ in the context of a modified AFLP method for genome complexity reduction coupled to multiplexing samples for high throughput sequencing. ​
- +
-**Table 5** Reaction mix for selective amplifications,​ in the context of a modified AFLP method for genome complexity reduction coupled to multiplexing samples for high throughput sequencing. ​+
 ^ Reagent ​   ^ Initial conc.    ^ Qty added    ^ Final conc. or Final qty    ^ ^ Reagent ​   ^ Initial conc.    ^ Qty added    ^ Final conc. or Final qty    ^
-^ HF Buffer ​   | 5X includes ​(15 mM MgCl2) | 6 µl  | 1X    |+^ HF Buffer ​   | 5X (includes ​15 mM MgCl2) | 6 µl  | 1X    |
 ^ MgCl2    | 50 mM    | 0.6  µl    | 2.5 mM    | ^ MgCl2    | 50 mM    | 0.6  µl    | 2.5 mM    |
 ^ dNTP     | 10 mM           | 0.6 µl         | 200 µM        | ^ dNTP     | 10 mM           | 0.6 µl         | 200 µM        |
Line 89: Line 98:
 ^ ddH2O    | -    | 17.76 µl    | -    | ^ ddH2O    | -    | 17.76 µl    | -    |
 ^ Total volume ​   ^ -    ^ 30 µl    ^ -    ^ ^ Total volume ​   ^ -    ^ 30 µl    ^ -    ^
 +</​WRAP>​
  
-**Table 6** Cycling conditions for selective amplifications,​ in the context of a modified AFLP method for genome complexity reduction coupled to multiplexing samples for high throughput sequencing.  +<WRAP box 500px>​{{:​amplify_digested_ligated_library.jpg?​400|Gel picture for selective amplification of prepared library for AFLP-like method}}**Figure 3** Electrophoresis of the product of selective amplification of digested-ligated //Panax quinqefolius//​ total DNA with selective primers, which have a MID barcode tail, for a modified AFLP method for genome complexity reduction coupled to a high throughput sequencing. Two different MgCl2 concentrations were tested, and different temperatures for the primer annealing step. Lane 1: [[http://​www.neb.ca/​detail.php?​id=N3014|Lambda BstEII ladder]]; Lane 2: 57 °C; Lane 3: 61.8 °C; Lane 4: 65.5; Lane 5: 68.7 °C; Lane 6: 57 °C; Lane 7: 61.8 °C; Lane 8: 65.5 °C; Lane 9: 68.7 °C</​WRAP>​ 
-^ Step      ^ Temperature (°C )       ^ Time          ^+<WRAP clear></​WRAP>​ 
 + 
 +<WRAP box 500px>**Table 6** Cycling conditions for selective amplifications,​ in the context of a modified AFLP method for genome complexity reduction coupled to multiplexing samples for high throughput sequencing.  
 +^ Step      ^ Temperature (°C)       ^ Time          ^
 | Initial denaturation ​   | 98   | 2 min    | | Initial denaturation ​   | 98   | 2 min    |
 ^ 30 cycles ​   ^     ​^ ​    ​^ ​ ^ 30 cycles ​   ^     ​^ ​    ​^ ​
Line 99: Line 112:
 ^ End of cycling ​   ^     ​^ ​    ^ ^ End of cycling ​   ^     ​^ ​    ^
 | Last polymerisation ​   | 72    | 5 min    | | Last polymerisation ​   | 72    | 5 min    |
- +</​WRAP>​ 
-[{{:​gel_amplif_12juillet2011.jpg?​300|**Figure 3** Electrophoresis of  from a selective amplification of digested-ligated ​//Panax quinqefolius//​ total DNA with selective primers, which have a MID barcode tail, for a modified AFLP method for genome complexity reduction coupled to a high throughput sequencing. Lane 1: [[http://​www.neb.ca/​detail.php?​id=N3014|Lambda BstEII ladder]]; Lane 2: ?}}] +<WRAP clear><​/WRAP>